Optically pure amines are an important class of chiral intermediates frequently used in the synthesis of active pharmaceutical ingredients, fine chemicals, and agrochemicals [1, 2]. For example, approximately 40% of the drugs approved by the FDA contain one or more chiral amine moieties [3, 4]. Due to the prevalent use of chiral amines in organic synthesis, efficient synthetic methods such as the asymmetric reductive amination of ketones and asymmetric reduction of ketimines using transition metal catalysts have been extensively developed [1, 2]. However, the direct asymmetric reductive amination of prochiral ketones with ammonia using transition metal catalysts, a key reaction for the synthesis of chiral amines, remains a challenge in industry [5, 6]. Moreover, these transition metal-catalyzed processes are usually expensive and unsustainable, often requiring harsh reaction conditions with tedious protection and deprotection steps.

With advances in protein engineering technology, biocatalytic processes have been extensively developed as promising alternatives to traditional chemocatalytic routes for the synthesis of chiral amines owing to their green credentials [7-14]. Numerous biocatalytic routes including (dynamic) kinetic resolution of racemic amines by lipases [15-18], transaminases [19-24], amine oxidases [25-32], and reductive aminases [33]; asymmetric reduction of imines by imine reductases (IREDs) [34-42] and artificial IREDs [43-45]; and asymmetric amination of ketones by IREDs [46-50], transaminases [51-56], reductive aminases [57], and amine dehydrogenases (AmDHs) [58-65] have been successfully developed for the synthesis of chiral amines. Among them, the AmDH-catalyzed asymmetric reductive amination of ketones is a particularly attractive route for the direct synthesis of chiral amines because it uses inexpensive ammonia as the amino donor and generates only water as the by-product.

Recently, a wild-type NADH-dependent AmDH from the thermophile Petrotoga mobilis was used for this reductive amination reaction. However, the enzyme only exhibited activity toward aliphatic ketoacids and not aliphatic ketones [66]. Bommarius and co-workers developed two new AmDHs via several rounds of protein engineering using naturally existing amino acid dehydrogenases as scaffolds [58, 59]. Subsequently, three other engineered AmDHs, including Rhodococcus Phe-AmDH from Rhodococcus sp. M4 [63], EsLeu-AmDH from Exiguobacterium sibiricum [68], and thermostable Cal-AmDH from Caldalkalibacillus thermarum [65], were developed using the same approach. These engineered AmDHs were used to synthesize a broad set of chiral amines with excellent enantioselectivity by reductive amination of ketones with ammonia. More importantly, two of them have been combined with alcohol dehydrogenases for the synthesis of chiral amines from inexpensive racemic alcohols through elegant hydrogen borrowing dual-enzyme cascade reactions [67, 68]. Very recently, we successfully expanded the substrate scope of three engineered AmDHs by fine-tuning two key residues surrounding the substrate-binding cavity, thus resulting in steric hindrance for the binding of bulky substrates [69].

However, all these engineered AmDHs display (R)-stereoselectivity. Therefore, only R-configuration chiral amines can be synthesized from the reductive amination of ketones with ammonia by these enzymes. To date, no (S)-stereoselective biocatalyst capable of catalyzing the reductive amination of ketones with ammonia has been reported. Herein, we report the isolation of microbial strains from soil samples able to catalyze the reductive amination of ketones using inexpensive inorganic ammonium as the amine donor for the synthesis of (S)-chiral amines.

Acetophenone (1a), 3, 4-dihydronaphthalen-1(2H)-one (1b), 1-(4-fluorophenyl)propan-2-one (pFPA) (1d), 1-(4- methoxyphenyl)propan-2-one (1g), 1-(3-fluorophenyl)propan-2-one (1e), 1-(2-fluorophenyl)propan-2-one (1f), (S)-α-methylbenzylamine, (R)-α-methylbenzylamine, (S, R)-4- fluoro-α-methylphenethylamine, (R)-1-(4-methoxyphenyl) propan-2-amine, (S)-1-(4-methoxyphenyl)propan-2-amine, and (S)-1, 2, 3, 4-tetrahydronaphthalen-1-amine were purchased from Sigma-Aldrich (Tianjin, China). All the other chemicals used were of analytical grade and commercially available. ¹H and ¹³C NMR spectra were recorded on a Bruker Avance 400 MHz spectrometer.

Different soil samples were collected from nature and enriched using the following medium at 30 ℃ for 48 h. Enrichment medium (per liter): (S)-α-methylbenzylamine, 0.6 g (5 mmol); glycerol, 2.0 g; KH₂PO₄, 3.0 g; NaCl, 1.0 g; MgSO₄·7H₂O, 0.5 g; and trace elements; pH 7.0. The single strain isolated was initially screened for the deamination of (S)-α-methylbenzylamine. The reaction mixture for deamination contained 5 mmol/L (S)-α-methylbenzylamine, wet cells from 4 mL cultured broth, and 0.5 mL glycine-NaOH buffer (0.2 mol/L, pH 10.0). The reaction was carried out at 30 ℃ and 1000 r/min for 24 h, and the products were analyzed by TLC. The strains producing acetophenone were rapidly identified and further screened for the reductive amination of acetophenone with ammonia. The reaction mixture for amination contained 5 mM acetophenone, wet cells from 4 mL cultured broth, 1 mol/L NH₄Cl, and 0.5 mL Tris-HCl buffer (0.2 mol/L, pH 8.0), which was shaken at 30 ℃ for 24 h. The products extracted from the reaction mixture were identified by GC.

For the identification of the microorganism, the 16S rDNA gene was amplified via the polymerase chain reaction (PCR) with the universal primer pair AGAGTTTGATCCTGGCTCAG and GGTTACCTTGTTACGACTT. The sequence was analyzed with the Basic Local Alignment Search Tool (BLAST). In order to identify the organism from the 16S rDNA gene sequence, the phylogenetics and molecular evolutionary genetics were constructed using the Clustal Omega and MEGA version 6.06 software. According to the 16S rDNA sequence of strain Es11, it was identified as Brevibacterium epidermidis ECU1015.

B. epidermidis ECU1015 was grown aerobically at 30 ℃ for 24 h in an optimized medium with the following composition (per liter): glycerol, 10.0 g; peptone, 5.0 g; yeast extract, 5.0 g; NaCl, 1.0 g; KH₂PO₄, 0.5 g; and MgSO₄, 0.2 g; pH 7.0. After cultivation, the cells were harvested by centrifugation (8000 r/min, 10 min) and washed twice with physiological saline.

The effect of the concentration of inorganic ammonium on the reductive amination catalyzed by B. epidermidis ECU1015 whole cells was studied at different concentrations of NH₄Cl. The reaction mixture (1 mL) contained 5 mmol/L pFPA (1d), different concentrations of NH₄Cl ranging from 0 to 2 mol/L, 100 g/L wet cells of B. epidermidis, 4% (v/v) DMSO, and potassium phosphate sulfate (KPB) (0.2 mol/L, pH 7.5). The reactions were performed at 30 ℃ and 1000 r/min for 24 h. The samples were treated by addition of 100 μL NaOH (10 mol/L) and extracted with dichloromethane (600 μL). The organic layer was dried over anhydrous sodium sulfate. The concentration and enantiomeric excess (ee) of the products were determined by GC analysis.

To study the effect of the pH on the B. epidermidis ECU1015-catalyzed reductive amination reaction, the experiments were performed at different initial pH values at 30 ℃ for 24 h. The reaction mixture included 0.5 mL whole-cells containing 100 g/L wet cells of B. epidermidis, 5 mmol/L pFPA, 1.25 mol/L NH₄Cl, 4% (v/v) DMSO, and different buffers with pH values ranging from 6.0 to 10.0: KPB (pH 6.0 to 7.5), Tris-HCl (pH 7.5 to 9.0), and glycine-NaOH (pH 9.0 to 10.0).

The effect of the temperature was studied by running experiments at different temperatures ranging from 25 to 40 ℃ for 24 h. The reaction mixture was composed of 100 g/L wet cells of B. epidermidis, 5 mM pFPA, 1.25 mol/L NH₄Cl, 4% (v/v) DMSO, and 0.5 mL KPB (0.2 mol/L, pH 7.5).

The samples were treated by addition of 0.1 mL NaOH (10 mol/L) and then extracted with dichloromethane (600 μL). The organic layer was dried over anhydrous sodium sulfate. The concentration and ee of the products were determined by GC analysis.

To research the effect of the substrate concentration on the reductive amination reaction, experiments with mixtures containing 100 g/L wet cells of B. epidermidis, 1.25 mol/L NH₄Cl, 4% (v/v) DMSO, pFPA at concentrations ranging from 5 to 30 mmol/L, and 0.5 mL KPB (0.2 mol/L, pH 7.5) were carried out at 30 ℃ for 24 h.

Mixtures composed of 10 mmol/L of ketone (1a-1e), 1.25 mol/L NH₄Cl, 100 g/L wet cells of B. epidermidis, 4% (v/v) DMSO, and 0.5 mL KPB (0.2 mol/L, pH 7.5) were shaken at 1000 r/min in sealed 2 mL tubes at 30 ℃ for 24 h. The samples were treated by addition of 0.1 mL NaOH (10 mol/L), and then extracted with dichloromethane (600 μL). The organic layer was dried over anhydrous sodium sulfate. The substrate conversion and product ee were determined by GC analysis.

Wet cells of B. epidermidis ECU1015 (10 g), 152 mg 1d(10 mmol/L), 1.25 mol/L NH₄Cl, 4% (v/v) DMSO, and 100 mL KPB (0.2 mol/L, pH 7.5) were mixed in a 250-mL round bottom flask. The reaction mixture was shaken in an incubator at 30 ℃. The reaction was monitored by GC. When the conversion reached a plateau, the reaction mixture was acidified to pH 2.0 by addition of HCl (1 mol/L). The water layer was washed with 100 mL CH₂Cl₂ to remove any unreacted ketone, the pH adjusted to 12.0-14.0 using NaOH (10 mol/L), and extracted with 100 mL CH₂Cl₂. The organic fractions containing the amine product were dried over anhydrous Na₂SO₄ and concentrated. An ethereal solution of HCl (2 mol/L, 2 mL) was added to the remaining product to precipitate the corresponding amine hydrochloride. The precipitate was dried under reduced pressure to afford the corresponding amine hydrochloride.

Conversion analysis: the substrate conversion was determined with a GC-2014 gas chromatograph (Shimadzu, Tokyo, Japan) equipped with an FID detector and a DB-1701 column (Agilent, 30 m × 0.25 mm × 0.25 μm) using N₂ as the carrier gas. n-Dodecane was used as the internal standard. The injector and detector temperatures were set to 250 and 280 ℃, respectively. The initial column temperature of 120 ℃ was held for 2 min, raised to 150 ℃ at a rate of 10 ℃/min and held for 1 min, then raised to 200 ℃ at a rate of 20 ℃/min, and finally held for 15 min.

Enantiomeric excess analysis: The samples were first derivatized by adding pyridine (2 μL) and acetic anhydride (5 μL) at room temperature for 30 min, and then characterized by GC-2014 gas chromatography (Shimadzu, Tokyo, Japan) equipped with an FID detector and a CP-Chiral-DEX CB column (Agilent, 25 m × 0.25 mm × 0.25 μm) using N₂ as the carrier gas. The injector and detector temperatures were both set to 280 ℃. The initial column temperature of 70 ℃ was held for 2 min, raised to 120 ℃ at a rate of 20 ℃/min and held for 2 min, then raised to 160 ℃ at a rate of 10 ℃/min and held for 2 min, and finally raised to 180 ℃ at a rate of 10 ℃/min and held for 2 min.

Initially, various microorganisms were isolated from soil samples through enrichment culturing using (S)-α-methylbenzylamine ((S)-α-MBA) as the sole nitrogen source. The strains showing clear formation of acetophenone on the silica gel plates by TLC analysis were selected and further examined for amination activity, using acetophenone (Scheme 1, 1a) as the model substrate in the presence of inorganic ammonium. Among them, two candidate strains were found to catalyze the reductive amination of 1a to (S)-α-MBA with > 99% ee, albeit with low conversion (Table 1). Moreover, these two candidate strains could also convert pFPA (1d) into the corresponding (S)-4-fluoro-α-methylphenethylamine with > 99% ee (Table 1). In this reaction, strain Es11 yielded a higher conversion than strain Fm98 and was therefore chosen for further studies. Strain Es11 was subsequently identified as Brevibacterium epidermidis ECU1015 by 16S rDNA sequencing and hereafter designated as B. epidermidis ECU1015.

To choose the most suitable amino donors, we first examined the effect of different amino compounds on the synthesis of (S)-pFPAm from pFPA. As shown in Fig. 1(a), using NH₄Cl as the amino donor, the reaction afforded the highest product yield. Therefore, NH₄Cl was selected as the amino donor for the reductive amination reactions.

Subsequently, different concentrations of NH₄Cl ranging from 0.25 to 2.0 mol/L were used for the amination of substrate pFPA to investigate the effect of the NH₄⁺ concentration on the reductive amination activity of B. epidermidis. As shown in Fig. 1(b), the concentration of the product (S)-4-fluoro-α-methylphenethylamine is strongly affected by the NH₄⁺ concentration. The concentration of the product increased with the NH₄⁺ concentration and then decreased at ionic concentrations greater than 1.25 mol/L. In general, the enzymes used for the reductive amination of achiral ketones such as amine dehydrogenases [66-69] display poor affinity toward ammonia. Therefore, the supra-stoichiometric addition of ammonia is necessary to drive the reaction equilibrium in the desired direction. For example, Carine Vergne-Vaxelaire and co-workers identified a natural amine dehydrogenase from Petrotoga mobilis. The enzyme catalyzed the transformation of 4-ketopentanoic acid (10 mmol/L) to 4-aminopentanoic acid using 5 mol/L free ammonia as the amine donor [64]. Therefore, 1.25 mol/L was chosen as the optimal NH₄⁺ concentration for the reductive amination of pFPA by B. epidermidis.

To determine the optimal pH, the B. epidermidis-catalyzed reductive amination of pFPA was conducted at pH values ranging from 6.0 to 10.0. As shown in Fig. 2(a), the highest product concentration was obtained at pH 7.5. Thus, pH 7.5 was chosen as the optimal pH for the asymmetric reductive amination of pFPA by B. epidermidis.

Similarly, the effect of temperature (25-40 ℃) was also studied. The concentration of the product formed increased with temperature from 25 to 30 ℃ to then decrease at higher temperatures (Fig. 2(b)). Hence, 30 ℃ was chosen as the optimum reaction temperature for the asymmetric reductive amination reaction catalyzed by B. epidermidis.

The substrate concentration was also found to have a significant effect on the asymmetric reductive amination catalyzed by B. epidermidis. Therefore, the reductive amination reaction was carried out for 24 h at different substrate concentrations. As shown in Fig. 3, the concentration of the product increased with the substrate concentration up to 10 mmol/L, after which it decreased. Therefore, 10 mmol/L was chosen as the optimal substrate concentration.

Under the optimal reaction conditions, the asymmetric reductive amination of a range of ketones (Scheme 1, 1a-1g) catalyzed by B. epidermidis ECU1015 was investigated, and the results are shown in Table 2. For acetophenone 1a, B. epidermidis ECU1015 exhibited very low reactivity, affording only 9.7% conversion (Table 2, entry 1), while no measurable reactivity for bulky substrate 1b was observed, suggesting that the steric hindrance of this bulky substrate severely hampers its transformation. In addition, B. epidermidis exhibited almost no activity toward aliphatic ketone 1c. Pleasingly, B. epidermidis ECU1015 displayed higher activity toward para-fluorophenylacetone 1d bearing a more electron-withdrawing substituent than acetophenone 1a, whereby 53% of 1d was converted into the corresponding (S)-amine with > 99% ee within 30 h (Table 2, entry 4), suggesting that electron-withdrawing substituents may activate the carbonyl carbon of the substrates [70, 71]. Subsequently, other phenylacetone derivatives such as meta-, ortho-fluoro-, and para-methoxy-substituted phenylacetones 1e-1g were examined. Conversions of 45%-68% were achieved in the B. epidermidis-catalyzed reductive amination of 1e-1g and the corresponding chiral amines were obtained in > 99% ee with (S)-selectivity (Table 2, entries 5-7). The moderate conversions are possibly caused by poor expression of the target enzyme in the natural host. Therefore, it should be possible to further increase the conversion using recombinant enzymes or highly active engineered mutants in the future.

The reductive amination product of substrate 1d, (S)-4-fluoro-α-methylphenethylamine, is an important chiral building block for the synthesis of human adenosine receptor agonists [72]. To assess the feasibility of this process, 1d was subjected to preparative synthesis at 100 mL reaction scale. The resulting time-course (Fig. 4) shows that the substrate was converted into optically pure (S)-4-fluoro-α- methylphenethylamine with 50% conversion and > 99% ee within 36 h. After extraction and normal work-up, 58.3 mg of (S)-4-fluoro-α-methylphenethylamine hydrochloride was isolated in 30.6% yield and > 99% ee.

We have identified and characterized a new strain, namely B. epidermidis ECU1015, able to catalyze the reductive amination of ketones using inorganic ammonium as the amino donor to generate the corresponding (S)-chiral amines. The desired product (S)-pFPAm was obtained in enantiomeric excess of 99% and yield of 30.6% after process optimization. In addition, a range of (S)-aryl amines were synthesized by biocatalytic reductive amination of the corresponding ketones. Thus, B. epidermidis ECU1015 has been demonstrated to be a very promising biocatalyst for the asymmetric synthesis of (S)-chiral amines.