Evaluation of the toxicity of perfluorooctanoic acid toward human colorectal cancer cells using multi-dimensional approaches

doi:10.3724/SP.J.1123.2024.05022

Abstract

Abstract:

While human exposure to perfluorooctanoic acid (PFOA) can lead to ulcerative colitis, the molecular mechanisms responsible for PFOA-induced intestinal toxicity are unclear. Herein, we examined the toxicity of PFOA toward human colorectal cancer cells (HCT116) from three dimensions: the cytotoxic phenotype, cell respiration, and transcription levels of metabolism-related genes. Formazan was used to assess how PFOA exposure affects HCT116-cell relative viability, after which the mitochondrial respiratory activities of these cells were determined by analyzing extracellular flux. The quantitative real-time polymerase chain reaction (qPCR) method was used to detect metabolism-related gene expression levels. The cytotoxicity assay revealed that the HCT116 showed significantly inhibited relative activities compared to those of the control when exposed to 300 μmol/L PFOA for 48 h (p<0.01), with most cells retained at the G0/G1 stage. In contrast, the mitochondrial respiratory activities of the HCT116 were promoted by concentrations of PFOA as low as 50 μmol/L. Two genes related to cellular metabolism (dipeptidase 1 (DPEP1) and sphingosine kinase 1 (SPHK1)) were found to be related to the PFOA-promoted formation of ulcerative colitis using our self-developed Metabolic Gene and Pathway Query software and Comparative Toxicogenomics Database (CTD). The qPCR studies revealed that DPEP1 and SPHK1 expression levels were enhanced by 8-10 times in HCT116 exposed to 300 μmol/L PFOA relative to the control, whereas this trend was not observed for HCT116 exposed to 50 μmol/L PFOA. Collectively, these results suggest that the respiratory activity of cellular mitochondria may serve as an index for determining the interference effects associated with PFOA and that metabolic pathways mediated by DPEP1 and SPHK1 may be involved in the development of PFOA-induced ulcerative colitis. Future studies should investigate the relationships between changes in metabolism-related genes (DPEP1 and SPHK1) and the mitochondrial respiratory activities of intestinal cells, and verify the roles played by the DPEP1 and SPHK1 genes in PFOA-induced intestinal inflammation using in-vivo models.

Key words: perfluorooctanoic acid (PFOA), human colorectal enterotoxicity, metabolic disorder, Metabolic Gene and Pathway Query software

CLC Number:

O658

ZHANG Ruijia, LIN Yingshi, TU Lanyin, CHEN Zitong, ZHANG Weiwei, LUAN Tiangang, CHEN Baowei. Evaluation of the toxicity of perfluorooctanoic acid toward human colorectal cancer cells using multi-dimensional approaches[J]. Chinese Journal of Chromatography, 2025, 43(1): 96-103.

Figures/Tables 5

Table 1 Information of the primers for quantitative real-time polymerase chain reaction (qPCR)

Gene	5'-3' forward	5'-3' reverse
DPEP1	CAAGTGGCCGACCATCTGG	GGGACCCTTGGAACACCATC
SPHK1	GCTCTGGTGGTCATGTCTGG	CACAGCAATAGCGTGCAGT
GAPDH	GCACCGTCAAGGCTGAGAAC	TGGTGAAGAACGCCAGTGGA

Fig. 1 Cell relative activity of human colon cancer cells (HCT116) after treated with different concentrations of perfluorooctanoic acid (PFOA) for (a) 24 h and (b) 48 h (n=4), (c) live cell fluorescence images of HCT116 after treated with different concentrations of PFOA for 48 h **p<0.01.

Fig. 2 Cell cycle distribution of HCT116 after treated with different concentrations of PFOA for 48 h (n=3) G2/M: DNA postsynthetic phase (G2) and mitotic phase (M); S: DNA synthetic phase; G0/G1: resting phase (G0) and DNA presynthetic phase (G1).

Fig. 3 Effects of different concentrations of PFOA on (a) oxygen consumption rate (OCR), (b) basal-linked OCR, (c) adenosine triphosphate (ATP) synthesis-linked OCR, (d) maximal respiration rate, (e) spare respiratory capacity, (f) non-mitochondrial respiration oxygen consumption of HCT116 (n=5) * p<0.05.

Fig. 4 Relative expression levels of DPEP1 and SPHK1 genes of HCT116 after treated with different concentrations of PFOA for 48 h (n=4) All results were normalized to the negative control group. **p<0.01.

References

[1]	Stockholm Covention. All POPs Listed in the Stockholm Convention. [2024-04-29]. http://chm.pops.int/Implementation/Alternatives/AlternativestoPOPs/ChemicalslistedinAnnexA/tabid/5837/Default.aspx
[2]	Yuan W, Song S, Lu Y, et al. Sci Total Environ, 2024, 912: 168837
[3]	Wang C, Li Q, Lu Y, et al. Sci Total Environ, 2019, 657: 792
[4]	Zhang R, Ye J, Wei Q, et al. Sci Total Environ, 2018, 616/617: 1469
[5]	Li J, Wang L, Zhang X, et al. Sci Total Environ, 2022, 852: 158362
[6]	Hong S, Khim J S, Wang T, et al. Chemosphere, 2015, 129: 157
[7]	Steenland K, Zhao L, Winquist A, et al. Environ Health Perspect, 2013, 121: 900
[8]	Wang Y, Chen X, Wang B, et al. Aquat Toxicol, 2023, 262: 106655
[9]	Gimenez-Bastida J A, Surma M, Zielinski H. Toxicol In Vitro, 2015, 29: 1683
[10]	Zhang R, Lu W, Tu L, et al. Environ Pollut, 2023, 338: 122684
[11]	Beale D J, Sinclair G M, Shah R, et al. Sci Total Environ, 2022, 845: 157255
[12]	Kleszczynski K, Gardzielewski P, Mulkiewicz E, et al. Toxicol In Vitro, 2007, 21: 1206
[13]	Pierozan P, Jerneren F, Karlsson O. Arch Toxicol, 2018, 92: 1729
[14]	Zhang R, Yao Y, Tu L, et al. J Hazard Mater, 2021, 409: 125017
[15]	Souders C L, Sanchez C L, Malphurs W, et al. Neurotoxicology, 2021, 85: 160
[16]	Zhang R, Chen B, Lin L, et al. Sci Total Environ, 2021, 770: 145329
[17]	Walters M W, Bjork J A, Wallace K B. Toxicology, 2009, 264: 10
[18]	Tachibana K, Saito M, Imai J I, et al. Biomed Rep, 2017, 6: 423
[19]	Qu L, Shi K, Xu J, et al. Phytomedicine, 2022, 98: 153945
[20]	Wang Q, Wang Z, Zhang Z, et al. Chin J Cancer Res, 2021, 33: 271
[21]	Yuza K, Nagahashi M, Shimada Y, et al. J Surg Res, 2018, 231: 323
[22]	Huang C, Wang Y, Lin X, et al. Ecotoxicol Environ Saf, 2022, 242: 113897
[23]	Crespo I, San-Miguel B, Mauriz J L, et al. Nutrients, 2017, 9: 288