Chinese Journal of Chromatography ›› 2026, Vol. 44 ›› Issue (6): 629-638.DOI: 10.3724/SP.J.1123.2026.01003
• Articles • Previous Articles Next Articles
YANG Renyu1,2, FENG Tingze1,2, PEI Shaojun1,2, QI Huan1,*(
), PIAO Hailong1,2,*(
)
Received:2026-01-05
Online:2026-06-08
Published:2026-06-03
Supported by:CLC Number:
YANG Renyu, FENG Tingze, PEI Shaojun, QI Huan, PIAO Hailong. Using activity-based protein profiling method to explore the antitumor targets of spiramycin derivatives[J]. Chinese Journal of Chromatography, 2026, 44(6): 629-638.
Add to citation manager EndNote|Ris|BibTeX
URL: https://www.chrom-china.com/EN/10.3724/SP.J.1123.2026.01003
Fig. 1 Chemical structures of (a) drug n-hexanoyl spiramycin (h-SPM) and (b) probeThe structure of the probe is similar to the drug. The red part are the groups required for the click chemical reaction, which are different from the structure of the drug.
Fig. 2 Cell proliferation assay of h-SPM and probe (n=3)a. MHCC-97H; b. MDA-MB-231; c. A549; d. LN229. Four cell lines were used, and the cells were treated with h-SPM or probe at different concentrations. The survival rates were measured with CCK-8 Kit, and a series of curves showing the changes in survival rates with concentration were obtained.
Fig. 3 Fluorescence gel imaging of the probe-labeled proteinFrom left to right, the different bands represent the experimental groups numbered 1, 2, 3, 4, 5, 6, 7, 8, and 9. The different treatments for 1 and 2 are related to ultraviolet light, for 3-5 they are treated with different concentrations of probe, and for 6-9 they are pretreated with different concentrations of h-SPM before probe treatment. The gel was stained with Coomassie Brilliant Blue (CBB) to demonstrate that the protein content of each sample was the same.
| Gene set | Description |
|---|---|
| GO:0016192 | vesicle-mediated transport |
| GO:0045321 | leukocyte activation |
| GO:0045055 | regulated exocytosis |
| GO:0002263 | cell activation involved in immune response |
| GO:0002274 | myeloid leukocyte activation |
| GO:0001775 | cell activation |
| GO:0043312 | neutrophil degranulation |
| GO:0002283 | neutrophil activation involved in immune response |
| GO:0042119 | neutrophil activation |
| GO:0002446 | neutrophil mediated immunity |
Table 1 Cellular pathways related to the Gene Ontology (GO) analysis results
| Gene set | Description |
|---|---|
| GO:0016192 | vesicle-mediated transport |
| GO:0045321 | leukocyte activation |
| GO:0045055 | regulated exocytosis |
| GO:0002263 | cell activation involved in immune response |
| GO:0002274 | myeloid leukocyte activation |
| GO:0001775 | cell activation |
| GO:0043312 | neutrophil degranulation |
| GO:0002283 | neutrophil activation involved in immune response |
| GO:0042119 | neutrophil activation |
| GO:0002446 | neutrophil mediated immunity |
Fig. 4 Western Blotting of the potential target proteinsIn the GO analysis, proteins with the high correlation to the pathways were found: low-density lipoprotein receptor (LDLR), amyloid precursor protein (APP), transferrin receptor protein 1(TFRC) and insulin-like growth factor 2 receptor (IGF2R). In Western Blotting experiments, different doses of drugs were added at different times to observe the changes in the bands to determine which proteins were related to the drug’s effect.
Fig. 5 Cell proliferation assay of APP knockdown cell lines by shRNA (n=3)a. APP content in four different cell lines. Four different cell lines were constructed. The shc was the blank control group for the infection of empty vector viruses, while sh1, sh2 and sh3 were cell lines with APP knockdown. b. Curve diagrams of cell viability of various cell lines to drug concentration. The four different cell lines were cultured under different concentrations of h-SPM, and performed with CCK8 assay. The sequence of shRNA: sh1: CCCTGTTCATTGTAAGCACTT; sh2: GCAGACACAGACTA-TGCAGAT; sh3: GCCATCTTTGACCGAAACGAA. * p<0.05.
Fig. 6 Influence of drugs on cellular lysosomesa. Lysosome staining intensity. Added the lysosome fuels to the cells with and without drug addition, and cultured for different periods of time. After performing confocal imaging, quantify the photos using software to obtain the staining intensity histogram; b. Western Blotting detection of the changes of lysosome proteins lysosomal-associated membrane protein 1 (LAMP1) and cathepsin D (CTSD) after drug addition. Cultivate the cells under drug-added and non-drug-added conditions at different time points, extract the proteins from these cells for Western Blotting experiments, and obtain the results of protein changes after drug addition. ACTIN is served as a reference protein. * p<0.05.
|
| [1] | ZHANG Boxuan, HE Qinwen, HAN Baocang, MA Cundi, LUO Zhujun, MENG Xiangzhou. Assessment on data processing methods for nontarget identification of per- and polyfluoroalkyl substances using liquid chromatography-high-resolution mass spectrometry [J]. Chinese Journal of Chromatography, 2026, 44(4): 432-443. |
| [2] | LIU Sai, WANG Mo, WANG Wei. Analysis of urine biomarkers in urothelial carcinoma based on untargeted metabolomics [J]. Chinese Journal of Chromatography, 2026, 44(3): 329-337. |
| [3] | YANG Cheng, ZHANG Ao, GAO Zhanqi, SU Guanyong. A review and research prospects on the application of the XCMS mass-spectrometry data-processing software in the environmental science field [J]. Chinese Journal of Chromatography, 2025, 43(6): 585-593. |
| [4] | HU Yangyang, YANG Ge, QU Feng. Research advances in non-immobilized aptamer screening techniques for small-molecule targets [J]. Chinese Journal of Chromatography, 2025, 43(4): 297-308. |
| [5] | XU Fei, LIU Tianping, GUAN Yajin, HAO Weichao, WEN Dingsheng, XIE Shuilin, BIE Yanan. Analysis of ischemic stroke biomarkers based on non-targeted metabolomics [J]. Chinese Journal of Chromatography, 2025, 43(2): 139-147. |
| [6] | LIU Tong, QIN Weijie, YANG Hongjun. Recent advances in protein precipitation-based methods for drug-target screening [J]. Chinese Journal of Chromatography, 2024, 42(7): 613-622. |
| [7] | WANG Yating, YANG Yang, SUN Xiulan, JI Jian. Development of a widely-targeted metabolomics method based on gas chromatography-mass spectrometry [J]. Chinese Journal of Chromatography, 2023, 41(6): 520-526. |
| [8] | QU Tao, CHEN Yang, YANG Changjun, LIU Qisong, CHEN Hui, HE Zhiyong, WANG Zhaojun, CHEN Jie, ZENG Maomao. Pseudotargeted metabolomics analysis of pine pollen intervention in the liver of premature ovarian failure rats [J]. Chinese Journal of Chromatography, 2023, 41(1): 47-57. |
| [9] | LI Jiaying, WANG Guosheng, YE Mingliang, QIN Hongqiang. Advances in applications of activity-based chemical probes in the characterization of amino acid reactivities [J]. Chinese Journal of Chromatography, 2023, 41(1): 14-23. |
| [10] | MA Chang, CAO Rong, SUN Shuai, ZHANG Haijun, CHEN Jiping, XIONG Zhili, LU Xianbo. Screening of risky substances in sea cucumbers based on gas chromatography-orbitrap high-resolution mass spectrometry [J]. Chinese Journal of Chromatography, 2022, 40(10): 944-951. |
| [11] | HUANG Mengwen, WU Huan, YU Wei, WANG Ying, WANG Fengcan, ZHANG Chunchun, ZHOU Longsheng, LI Zegeng. Rapid identification of chemical components in Qi-Yu-San-Long decoction by ultra high performance liquid chromatography-quadrupole time-of-flight mass spectrometry [J]. Chinese Journal of Chromatography, 2021, 39(7): 730-743. |
| [12] | GONG Li, KANG Jingwu. Drug target deconvolution by chemical proteomics [J]. Chinese Journal of Chromatography, 2020, 38(8): 877-879. |
| [13] | LIU Xiaomin, XU Xiuli, NIE Xuemei, GUO Wei, ZHANG Feng. Research progress on the fragmentation mechanisms of mass spectrometry soft ionization and screening of chemical hazardous substances in food [J]. Chinese Journal of Chromatography, 2020, 38(7): 750-758. |
| [14] | LEI Ruqing, NIU Yumin, GUO Qiaozhen, SHAO Bing, DING Xiaojing. Non-targeted screening of triazole fungicides in tomatoes by ultra-high performance liquid chromatography-quadrupole-time of flight mass spectrometry [J]. Chinese Journal of Chromatography, 2020, 38(7): 805-816. |
| [15] | WANG Xiyue, MING Ming, LIAN Lili, ZHANG Hao, LOU Dawei. Analysis of fatty acids in rice by pseudotargeted metabolomics method based on gas chromatography-mass spectrometry [J]. Chinese Journal of Chromatography, 2020, 38(2): 250-254. |
| Viewed | ||||||
|
Full text |
|
|||||
|
Abstract |
|
|||||